Adapter detection

The NGS sequencing lab prepared libraries using the KAPA HyperPlus Kit (Roche), which were pooled and sequenced on an Illumina NovaSeq 6000 (SP flow cell, 2 × 250 bp paired-end run).

For raw data processing, I used fastp for adapter trimming. The detect_adapter_for_pe option identified Illumina TruSeq adapters. The KAPA HyperPlus Kit documentation states that its adapters are identical to TruSeq. However, the sequencing lab’s sheet lists the adapter sequence as CTGTCTCTTATACACATCT (with each sample also having P7 and P5 index sequences). This sequence (CTGTCT…) differs from the adapter detected by fastp:

>Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Given this discrepancy, what is the best way to confirm which adapter sequence was actually used in my libraries?

I would greatly appreciate insights from experts..