Kneaddata - a non very explicit error message

Hi guys,

I have been working in the past with kneaddata and I did not see this error before. I also checked in the forum before posting. Any tip is appreciated:

I ran kneaddata in my server, as usual. The log file from the server report an error:

ERROR: Unable to write file: /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/35231821S_R1.fastq/35231821S_R1_kneaddata.trimmed.1.fastq

However in the kneaddata log file I could not find a particular error about that file:

03/21/2022 10:51:44 AM - kneaddata.knead_data - INFO: Running kneaddata v0.10.0
03/21/2022 10:51:44 AM - kneaddata.knead_data - INFO: Output files will be written to: /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq
03/21/2022 10:51:44 AM - kneaddata.knead_data - DEBUG: Running with the following arguments:
verbose = False
input = /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R1.fastq /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R2.fastq
output_dir = /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq
reference_db = /rds/general/user/jm2018/ephemeral/biobakery_library/database_kneaddata/hg37dec_v0.1
bypass_trim = False
output_prefix = 3523185S_R1_kneaddata
threads = 6
processes = 1
trimmomatic_quality_scores = -phred33
bmtagger = False
bypass_trf = False
run_trf = False
fastqc_start = False
fastqc_end = False
store_temp_output = False
remove_intermediate_output = False
cat_final_output = False
log_level = DEBUG
log = /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.log
trimmomatic_path = /rds/general/user/jm2018/home/Trimmomatic-0.39/trimmomatic-0.39.jar
run_trim_repetitive = False
max_memory = 500m
trimmomatic_options = None
sequencer_source = NexteraPE
bowtie2_path = /rds/general/user/jm2018/home/anaconda3/envs/biobakery/bin/bowtie2
bowtie2_options = --very-sensitive-local --phred33
decontaminate_pairs = strict
reorder = False
serial = False
bmtagger_path = None
trf_path = /rds/general/user/jm2018/home/anaconda3/envs/biobakery/bin/trf
match = 2
mismatch = 7
delta = 7
pm = 80
pi = 10
minscore = 50
maxperiod = 500
fastqc_path = None
remove_temp_output = True
discordant = True

03/21/2022 10:55:02 AM - kneaddata.utilities - INFO: READ COUNT: raw pair1 : Initial number of reads ( /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R1.fastq ): 11761708.0
03/21/2022 10:58:52 AM - kneaddata.utilities - INFO: READ COUNT: raw pair2 : Initial number of reads ( /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R2.fastq ): 11761708.0
03/21/2022 10:58:52 AM - kneaddata.utilities - DEBUG: Checking input file to Trimmomatic : /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R1.fastq
03/21/2022 10:58:52 AM - kneaddata.utilities - DEBUG: Checking input file to Trimmomatic : /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R2.fastq
03/21/2022 10:58:52 AM - kneaddata.utilities - INFO: Running Trimmomatic …
03/21/2022 10:58:52 AM - kneaddata.utilities - INFO: Execute command: java -Xmx500m -jar /rds/general/user/jm2018/home/Trimmomatic-0.39/trimmomatic-0.39.jar PE -threads 6 -phred33 /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R1.fastq /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R2.fastq /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.1.fastq /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.single.1.fastq /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.2.fastq /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.single.2.fastq MINLEN:60 ILLUMINACLIP:/rds/general/user/jm2018/home/anaconda3/envs/biobakery/lib/python3.7/site-packages/kneaddata/adapters/NexteraPE-PE.fa:2:30:10:8:TRUE SLIDINGWINDOW:4:20 MINLEN:75
03/21/2022 11:04:52 AM - kneaddata.utilities - DEBUG: b"TrimmomaticPE: Started with arguments:\n -threads 6 -phred33 /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R1.fastq /rds/general/user/jm2018/ephemeral/unzip_raw/3523185S_R2.fastq /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.1.fastq /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.single.1.fastq /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.2.fastq /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.single.2.fastq MINLEN:60 ILLUMINACLIP:/rds/general/user/jm2018/home/anaconda3/envs/biobakery/lib/python3.7/site-packages/kneaddata/adapters/NexteraPE-PE.fa:2:30:10:8:TRUE SLIDINGWINDOW:4:20 MINLEN:75\nUsing PrefixPair: ‘AGATGTGTATAAGAGACAG’ and ‘AGATGTGTATAAGAGACAG’\nUsing Long Clipping Sequence: ‘GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG’\nUsing Long Clipping Sequence: ‘TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG’\nUsing Long Clipping Sequence: ‘CTGTCTCTTATACACATCTGACGCTGCCGACGA’\nUsing Long Clipping Sequence: ‘CTGTCTCTTATACACATCTCCGAGCCCACGAGAC’\nILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences\nInput Read Pairs: 11761708 Both Surviving: 9667227 (82.19%) Forward Only Surviving: 1442760 (12.27%) Reverse Only Surviving: 345569 (2.94%) Dropped: 306152 (2.60%)\nTrimmomaticPE: Completed successfully\n"
03/21/2022 11:04:52 AM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.1.fastq
03/21/2022 11:04:52 AM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.single.1.fastq
03/21/2022 11:04:52 AM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.2.fastq
03/21/2022 11:04:52 AM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.single.2.fastq
03/21/2022 11:06:16 AM - kneaddata.utilities - INFO: READ COUNT: trimmed pair1 : Total reads after trimming ( /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.1.fastq ): 9667227.0
03/21/2022 11:06:58 AM - kneaddata.utilities - INFO: READ COUNT: trimmed pair2 : Total reads after trimming ( /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.2.fastq ): 9667227.0
03/21/2022 11:07:05 AM - kneaddata.utilities - INFO: READ COUNT: trimmed orphan1 : Total reads after trimming ( /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.single.1.fastq ): 1442760.0
03/21/2022 11:07:07 AM - kneaddata.utilities - INFO: READ COUNT: trimmed orphan2 : Total reads after trimming ( /rds/general/user/jm2018/ephemeral/biobakery/kneaddata/3523185S_R1.fastq/3523185S_R1_kneaddata.trimmed.single.2.fastq ): 345569.0

The number of reads between file 1 and 2 is matched, what I suppose is good. Problem is that kneaddata stops there, there is no further file or outcome.

Any idea where the problem may be?

Thanks very much,

Jesus

3523185S_R1_kneaddata.txt (6.6 KB)