All paired-end read unmatched

Kneaddata (v0.10.0) result

I checked the log file, seemed as no error :

12/10/2021 04:46:24 PM - kneaddata.knead_data - INFO: Running kneaddata v0.10.0
12/10/2021 04:46:24 PM - kneaddata.knead_data - INFO: Output files will be written to: /public4/home/sc56690/data/temp/qc
12/10/2021 04:46:24 PM - kneaddata.knead_data - DEBUG: Running with the following arguments: 
verbose = True
bypass_trf = True
bmtagger_path = None
minscore = 50
bowtie2_path = /public4/home/sc56690/.conda/envs/humann2/bin/bowtie2
maxperiod = 500
discordant = True
serial = False
fastqc_start = False
store_temp_output = False
cat_final_output = False
log_level = DEBUG
log = /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.log
sequencer_source = NexteraPE
max_memory = 500m
remove_intermediate_output = True
fastqc_path = None
output_dir = /public4/home/sc56690/data/temp/qc
trf_path = None
remove_temp_output = True
reference_db = /public4/home/sc56690/db/kneaddata/human_genome/Homo_sapiens
input = /public4/home/sc56690/data/seq/1-1106_FDSW202359622-1r_1.fq /public4/home/sc56690/data/seq/1-1106_FDSW202359622-1r_2.fq
decontaminate_pairs = strict
reorder = False
pm = 80
trimmomatic_path = /public4/home/sc56690/.conda/envs/humann2/share/trimmomatic/trimmomatic.jar
run_trf = False
mismatch = 7
threads = 60
delta = 7
bowtie2_options = --very-sensitive --dovetail --phred33
bypass_trim = False
processes = 1
pi = 10
trimmomatic_quality_scores = -phred33
fastqc_end = False
trimmomatic_options = ILLUMINACLIP:/public4/home/sc56690/.conda/envs/humann2/share/trimmomatic/adapters/TruSeq2-PE.fa:2:40:15 SLIDINGWINDOW:4:20 MINLEN:50
output_prefix = 1-1106_FDSW202359622-1r_1_kneaddata
match = 2
bmtagger = False
run_trim_repetitive = False

12/10/2021 04:46:24 PM - kneaddata.utilities - INFO: Reformatting file sequence identifiers ...
12/10/2021 04:47:48 PM - kneaddata.utilities - INFO: Reformatting file sequence identifiers ...
12/10/2021 04:49:14 PM - kneaddata.utilities - INFO: Reordering read identifiers ...
12/10/2021 05:09:34 PM - kneaddata.utilities - INFO: READ COUNT: raw pair1 : Initial number of reads ( /public4/home/sc56690/data/temp/qc/reordered_QejgrJ_reformatted_identifiersxZBJaz_1-1106_FDSW202359622-1r_1 ): 36029417
12/10/2021 05:09:46 PM - kneaddata.utilities - INFO: READ COUNT: raw pair2 : Initial number of reads ( /public4/home/sc56690/data/temp/qc/reordered_EY7eUu_reformatted_identifiersL3KgSn_1-1106_FDSW202359622-1r_2 ): 36029417
12/10/2021 05:09:46 PM - kneaddata.utilities - DEBUG: Checking input file to Trimmomatic : /public4/home/sc56690/data/temp/qc/reordered_QejgrJ_reformatted_identifiersxZBJaz_1-1106_FDSW202359622-1r_1
12/10/2021 05:09:46 PM - kneaddata.utilities - DEBUG: Checking input file to Trimmomatic : /public4/home/sc56690/data/temp/qc/reordered_EY7eUu_reformatted_identifiersL3KgSn_1-1106_FDSW202359622-1r_2
12/10/2021 05:09:46 PM - kneaddata.utilities - INFO: Running Trimmomatic ... 
12/10/2021 05:09:46 PM - kneaddata.utilities - INFO: Execute command: java -Xmx500m -jar /public4/home/sc56690/.conda/envs/humann2/share/trimmomatic/trimmomatic.jar PE -threads 60 -phred33 /public4/home/sc56690/data/temp/qc/reordered_QejgrJ_reformatted_identifiersxZBJaz_1-1106_FDSW202359622-1r_1 /public4/home/sc56690/data/temp/qc/reordered_EY7eUu_reformatted_identifiersL3KgSn_1-1106_FDSW202359622-1r_2 /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.1.fastq /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.1.fastq /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.2.fastq /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.2.fastq ILLUMINACLIP:/public4/home/sc56690/.conda/envs/humann2/share/trimmomatic/adapters/TruSeq2-PE.fa:2:40:15 SLIDINGWINDOW:4:20 MINLEN:50
12/10/2021 05:12:07 PM - kneaddata.utilities - DEBUG: TrimmomaticPE: Started with arguments:
-threads 60 -phred33 /public4/home/sc56690/data/temp/qc/reordered_QejgrJ_reformatted_identifiersxZBJaz_1-1106_FDSW202359622-1r_1 /public4/home/sc56690/data/temp/qc/reordered_EY7eUu_reformatted_identifiersL3KgSn_1-1106_FDSW202359622-1r_2 /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.1.fastq /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.1.fastq /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.2.fastq /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.2.fastq ILLUMINACLIP:/public4/home/sc56690/.conda/envs/humann2/share/trimmomatic/adapters/TruSeq2-PE.fa:2:40:15 SLIDINGWINDOW:4:20 MINLEN:50
Using PrefixPair: 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG'
Using Long Clipping Sequence: 'TTTTTTTTTTAATGATACGGCGACCACCGAGATCTACAC'
Using Long Clipping Sequence: 'TTTTTTTTTTCAAGCAGAAGACGGCATACGA'
Using Long Clipping Sequence: 'CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 6 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 36029417 Both Surviving: 34592816 (96.01%) Forward Only Surviving: 527242 (1.46%) Reverse Only Surviving: 603448 (1.67%) Dropped: 305911 (0.85%)
TrimmomaticPE: Completed successfully

12/10/2021 05:12:07 PM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.1.fastq
12/10/2021 05:12:07 PM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.1.fastq
12/10/2021 05:12:07 PM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.2.fastq
12/10/2021 05:12:07 PM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.2.fastq
12/10/2021 05:12:20 PM - kneaddata.utilities - INFO: READ COUNT: trimmed pair1 : Total reads after trimming ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.1.fastq ): 34592816
12/10/2021 05:12:34 PM - kneaddata.utilities - INFO: READ COUNT: trimmed pair2 : Total reads after trimming ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.2.fastq ): 34592816
12/10/2021 05:12:34 PM - kneaddata.utilities - INFO: READ COUNT: trimmed orphan1 : Total reads after trimming 
( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.1.fastq ): 527242
12/10/2021 05:12:34 PM - kneaddata.utilities - INFO: READ COUNT: trimmed orphan2 : Total reads after trimming 
( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.2.fastq ): 603448
12/10/2021 05:12:34 PM - kneaddata.run - INFO: Decontaminating ...
12/10/2021 05:12:35 PM - kneaddata.utilities - DEBUG: Checking input file to bowtie2 : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.1.fastq
12/10/2021 05:12:35 PM - kneaddata.utilities - DEBUG: Checking input file to bowtie2 : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.2.fastq
12/10/2021 05:12:35 PM - kneaddata.utilities - DEBUG: Checking input file to bowtie2 : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.1.fastq
12/10/2021 05:12:35 PM - kneaddata.utilities - DEBUG: Checking input file to bowtie2 : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.2.fastq
12/10/2021 05:12:35 PM - kneaddata.utilities - INFO: Running bowtie2 ... 
12/10/2021 05:12:35 PM - kneaddata.utilities - INFO: Execute command: kneaddata_bowtie2_discordant_pairs --bowtie2 /public4/home/sc56690/.conda/envs/humann2/bin/bowtie2 --threads 60 -x /public4/home/sc56690/db/kneaddata/human_genome/Homo_sapiens --mode strict --bowtie2-options "--very-sensitive --dovetail --phred33" -1 /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.1.fastq -2 /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.2.fastq --un-pair /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_clean_%.fastq --al-pair /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_contam_%.fastq -U /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.1.fastq,/public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata.trimmed.single.2.fastq --un-single /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_unmatched_%_clean.fastq --al-single /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_unmatched_%_contam.fastq -S /dev/null
12/10/2021 05:29:20 PM - kneaddata.utilities - DEBUG: 70316322 reads; of these:
  70316322 (100.00%) were unpaired; of these:
    70313909 (100.00%) aligned 0 times
    579 (0.00%) aligned exactly 1 time
    1834 (0.00%) aligned >1 times
0.00% overall alignment rate
pair1_aligned : 0
pair2_aligned : 0
orphan1_unaligned : 35119566
orphan2_unaligned : 35194343
orphan2_aligned : 1921
pair2_unaligned : 0
pair1_unaligned : 0
orphan1_aligned : 492

12/10/2021 05:29:20 PM - kneaddata.utilities - DEBUG: Checking output file from bowtie2 : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_clean_1.fastq
12/10/2021 05:29:20 PM - kneaddata.utilities - DEBUG: Checking output file from bowtie2 : /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_clean_2.fastq
12/10/2021 05:29:21 PM - kneaddata.run - INFO: Total contaminate sequences in file ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_contam_1.fastq ) : 0
12/10/2021 05:29:21 PM - kneaddata.run - INFO: Total contaminate sequences in file ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_contam_2.fastq ) : 0
12/10/2021 05:29:21 PM - kneaddata.run - INFO: Total contaminate sequences in file ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_unmatched_1_contam.fastq ) : 492
12/10/2021 05:29:21 PM - kneaddata.run - INFO: Total contaminate sequences in file ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_unmatched_2_contam.fastq ) : 1921
12/10/2021 05:29:21 PM - kneaddata.utilities - INFO: READ COUNT: decontaminated Homo_sapiens pair1 : Total reads after removing those found in reference database ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_clean_1.fastq ): 0
12/10/2021 05:29:21 PM - kneaddata.utilities - INFO: READ COUNT: decontaminated Homo_sapiens pair2 : Total reads after removing those found in reference database ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_clean_2.fastq ): 0
12/10/2021 05:29:21 PM - kneaddata.utilities - INFO: READ COUNT: final pair1 : Total reads after merging results from multiple databases ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_paired_1.fastq ): 0
12/10/2021 05:29:21 PM - kneaddata.utilities - INFO: READ COUNT: final pair2 : Total reads after merging results from multiple databases ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_paired_2.fastq ): 0
12/10/2021 05:29:21 PM - kneaddata.utilities - WARNING: Unable to remove file: /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_clean_1.fastq
12/10/2021 05:29:21 PM - kneaddata.utilities - WARNING: Unable to remove file: /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_paired_clean_2.fastq
12/10/2021 05:29:33 PM - kneaddata.utilities - INFO: READ COUNT: decontaminated Homo_sapiens orphan1 : Total reads after removing those found in reference database ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_unmatched_1_clean.fastq ): 35119566
12/10/2021 05:29:46 PM - kneaddata.utilities - INFO: READ COUNT: final orphan1 : Total reads after merging results from multiple databases ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_unmatched_1.fastq ): 35119566
12/10/2021 05:29:46 PM - kneaddata.utilities - WARNING: Unable to remove file: /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_unmatched_1_clean.fastq
12/10/2021 05:30:02 PM - kneaddata.utilities - INFO: READ COUNT: decontaminated Homo_sapiens orphan2 : Total reads after removing those found in reference database ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_unmatched_2_clean.fastq ): 35194343
12/10/2021 05:30:14 PM - kneaddata.utilities - INFO: READ COUNT: final orphan2 : Total reads after merging results from multiple databases ( /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_unmatched_2.fastq ): 35194343
12/10/2021 05:30:14 PM - kneaddata.utilities - WARNING: Unable to remove file: /public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_Homo_sapiens_bowtie2_unmatched_2_clean.fastq
12/10/2021 05:30:24 PM - kneaddata.knead_data - INFO: 
Final output files created: 
/public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_paired_1.fastq
/public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_paired_2.fastq
/public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_unmatched_1.fastq
/public4/home/sc56690/data/temp/qc/1-1106_FDSW202359622-1r_1_kneaddata_unmatched_2.fastq

This happens. I have no idea what the design choice was for this.
They actually take all the reads and put them into one file. You’ll also see singletons/orphans in your data too, as an artifact of trimming and filtering.

The same happened to my samples. Don’t know if it’s a bug or expected output.

This is the case because kneaddata does not recognize sequence labels. When I changed to other sequences with a different label, the problem was solved