kneaddata v0.12.0
After trimming reads, no paired end reads are found. A potential solution exists in a github pull request. I believe there were some issues with the commit, I’m unsure of the best course of action to commit these changes.
My read headers look like the following:@VL00488 :61:AAFM2HTM5:1:1101:50725:1000 1:N:0:CGTTGCAA+ATAGAGCG
Could you please share the command you used to modify the header?
biobakery:master ← EacoChen:master
opened 03:02PM - 03 Sep 22 UTC
We welcome feedback and issue reporting for all bioBakery tools through our [Dis… course site]
https://forum.biobakery.org/c/pull-request/featurepull-request/). For users that would like to directly contribute to the [tools](https://github.com/biobakery/) we are happy to field PRs to address **bug fixes**. Please note the turn around time on our end might be a bit long to field these but that does not mean we don't value the contribution! We currently **don't** accept PRs to add **new functionality** to tools but we would be happy to receive your feedback on [Discourse]
https://forum.biobakery.org/c/pull-request/featurepull-request/).
Also, we will make sure to attribute your contribution in our User’s manual(README.md) and in any associated paper Acknowledgements.
## Description
Add a new "if" in utilities.get_reformatted_identifiers function
Using the regular expression r'\d+:N:\d+:(?=[A|T|C|G])' to get the issue part of sequence label.
And then just delete it.
## Related Issue
I found some users alway get zero file of two paired files [issue1]
(https://forum.biobakery.org/t/paired-end-data-results-in-unpaired-output/928/2) [issue2]
(https://forum.biobakery.org/t/no-reads-in-the-final-output-files-created/3419).
I also have that issue, my sequence label was like
R1: @A00456:506:H5GC2DSXY:1:1101:6027:1000 1:N:0:CAACACAG+CAAGGTAC
R2: @A00456:506:H5GC2DSXY:1:1101:6027:1000 2:N:0:CAACACAG+CAAGGTAC
So. in old "get_reformatted_identifiers adding" "#0/1" and "#0/2" not solving this issue. and I just delete the part. it worked.
## Screenshots (if appropriate):
marvin
August 10, 2024, 7:16am
2
I just cloned the latest git version and it worked.
v0.12.0? I get 0 paired end reads. What format is your header?
marvin
August 11, 2024, 3:49am
4
This is my header format.
@LH00169:221:22352TLT4:7:1101:51633:1042 1:N:0:ATGGTAAC+GTCTACCG
ANGGCTGAATAACCCGGATCTCGACGCTGCGGTTGGTGAAGATCTGGCACAGCAGCTACGTGACGAACTGGAACTGGTGAAAGGCGCGTCTAACGAGTTCGACAAAGAATTGTTCCTTGCGGGCGAAATCACTCCGGTATTCTTCGGTAC
+
I#II9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@LH00169:221:22352TLT4:7:1101:51633:1042 2:N:0:ATGGTAAC+GTCTACCG
ANATACGAAGCAGGTAAATTTGTCTTCGCTCGCTTCTACGGTACGGGTATCAGTCTGACGCGGCATCGGCGCAGGTGCCCACTCCACCAGGCCATCCAGCATATGATCGACGCCGAAGTTACCAAGCGCAGTACCGAAGAATACCGGAGT
+
I#IIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIII
Hm, I think the pip installation of kneaddata is behind then? when my YAML file in conda stored the kneaddata version like so -
I get an older utilities.py file.
When my YAML file has kneaddata instead like so
kneaddata=0.12.0=pyhdfd78af_1,
it works?