BLAST - Local id is too long

Microbial community profiling StrainPhlAn
1

Hello,
I ran StrainPhlAn and got the following error:

BLAST Database creation error: Near line 2936886, the local id is too long. Its length is 56 but the maximum allowed local id length is 50. Please find and correct all local ids that are too long.

After going through the provided inputs I think I have narrowed the problem to the --references input. Apparently BLAST is not happy working with marker ids having more than 50 characters.

This is the entry in the FASTA that is creating this error:

>136841__A0A0A8RMF6__PAERUG_P44_Wales_1_VIM_2_11_12_06045 UniRef90_A0A0A8RMF6;k__Bacteria|p__Proteobacteria|c__Gammaproteobacteria|o__Pseudomonadales|f__Pseudomonadaceae|g__Pseudomonas|s__Pseudomonas_aeruginosa_group;GCA_001182945
ATGTTTCAAAGTACCGAGCAGGCGCTGGCCGTGGCCTACTGGATGTTCGAGCACCAGCCG
GGACCGAAGTCGTCGACGGCGATGGTGATCGATGGCCTGCGCGAGCGCTTCGATCGCAGC
TTCATCGAACACCTGCCCAGCGGTTTGAGTCCGCACGAATGGCAGGCCCAGGCGGTGATG
ACCGTGCGTTTCGCCCAGCGCCAGTTGGCTGCGCACCCACTGGAGCTGGCGGTGGTGCGG

In fact the id 136841__A0A0A8RMF6__PAERUG_P44_Wales_1_VIM_2_11_12_06045 has 56 characters, apparently way too many, any suggestions on how to proceed?

Iā€™m using as reference the FASTA file obtained from running the following:

metaphlan --install

Bests!

2

An update on this entry: I was providing the wrong FASTA for the --references input. The one I was using contains the markers, not the genomes, which is the one the program expects.
Nonetheless, if a local id in a genome reference FASTA happens to contain more than 50 characters, this error will also rise.

3

Hi @david-castillo
Thanks for reporting this. We will add a fix to this problem in the next release!

1 Like