# Adapter detection

**URL:** <https://forum.biobakery.org/t/adapter-detection/8899>\
**Category:** KneadData\
**Created:** [May 7, 2026, 10:15am UTC](https://forum.biobakery.org/t/adapter-detection/8899 "2026-05-07T10:15:13Z")\
**Posts on this page:** 3\
**Page:** 1

<div class="post-metadata">

**Author:** ![KSK](https://avatars.discourse-cdn.com/v4/letter/k/ac8455/32.png) [@KSK](https://forum.biobakery.org/u/KSK)\
**Post date:** [May 7, 2026, 10:15am UTC](https://forum.biobakery.org/t/adapter-detection/8899/1 "2026-05-07T10:15:13Z")

</div>

The NGS sequencing lab prepared libraries using the **KAPA HyperPlus Kit (Roche)**, which were pooled and sequenced on an **Illumina NovaSeq 6000** (SP flow cell, 2 × 250 bp paired-end run).

For raw data processing, I used **fastp** for adapter trimming. The `detect_adapter_for_pe` option identified **Illumina TruSeq adapters**. The KAPA HyperPlus Kit documentation states that its adapters are identical to TruSeq. However, the sequencing lab’s sheet lists the adapter sequence as **CTGTCTCTTATACACATCT** (with each sample also having P7 and P5 index sequences). This sequence (CTGTCT…) differs from the adapter detected by fastp:

`>Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA`

Given this discrepancy, what is the best way to confirm which adapter sequence was actually used in my libraries?

I would greatly appreciate insights from experts..

---

<div class="post-metadata">

**Author:** ![KSK](https://avatars.discourse-cdn.com/v4/letter/k/ac8455/32.png) [@KSK](https://forum.biobakery.org/u/KSK)\
**Post date:** [May 18, 2026, 11:06am UTC](https://forum.biobakery.org/t/adapter-detection/8899/2 "2026-05-18T11:06:18Z")

</div>

Hi, Could anyone pls share some insights…thank you

---

<div class="post-metadata">

**Author:** ![tkuntz-hsph](https://yyz1.discourse-cdn.com/flex027/user_avatar/forum.biobakery.org/tkuntz-hsph/32/492_2.png) [@tkuntz-hsph](https://forum.biobakery.org/u/tkuntz-hsph)\
**Post date:** [May 18, 2026, 3:21pm UTC](https://forum.biobakery.org/t/adapter-detection/8899/3 "2026-05-18T15:21:03Z")

</div>

Hi,

We usually use the biobakery tool, [kneaddata](https://github.com/biobakery/kneaddata), for quality control. It has some default adapters it checks for, but in this case, you can add the --run-fastqc-start, --run-fastqc-end, and --run-trim-repetitive flags to have it check for adapters, remove them, and then check if there are any remaining overrepresented sequences.